Review



ssoadvanced sybr green supermix  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad ssoadvanced sybr green supermix
    Ssoadvanced Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 8767 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc13116153-279-18-24
    Average 99 stars, based on 8767 article reviews
    ssoadvanced sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: p75 neurotrophin receptor preserves neuromuscular synapse stability and muscle strength during aging.
    Article Snippet: Muscles were homogenised using sonicator (Misonix) in Trizol (Ambion) and RNA was extracted following the manufacturer’s instructions. cDNA synthesis from 1ug of RNA, was performed using the RevertAid Kit (Invitrogen). .. RTqPCR was performed on a Rotor-Gene Q (Qiagen) using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and primers targeting p75NTR and GAPDH. ..

    Article Title: Nickase NmCas9 unsilences paternal Ube3a in a mouse model of Angelman syndrome without causing AAV vector integration.
    Article Snippet: We treated total RNA with ezDNase and reverse transcribed using SuperScript IV VILO (11766050, Invitrogen). .. We performed all RT-qPCR experiments using SsoAdvanced Universal SYBR Green Supermix (1725271, Bio-Rad) or PowerTrack SYBR Green Mastermix (A46109, Applied Biosystems) on a QuantStudio5 (Applied Biosystems). ..

    Article Title: Separating food intake-dependent and -independent effects in cancer cachexia
    Article Snippet: One microgram of purified RNA was converted to cDNA using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, #1708840). .. The diluted cDNA was used for RT-qPCR using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, #1725270) with the CFX384 Real-Time PCR detection System (Bio-Rad). ..

    Article Title: Separating food intake-dependent and -independent effects in cancer cachexia
    Article Snippet: iScript Reverse Transcription Supermix , Bio-Rad , Cat#1708840. .. SsoAdvanced Universal SYBR Green Supermix , Bio-Rad , Cat#1725270. ..

    Article Title: Extracts from the Edible Mushroom Sparassis crispa : Nematicidal, Antimicrobial, and Antiviral Properties Supporting Its Functional Food Potential.
    Article Snippet: .. The DNA isolates from anti-HSV-1 assays were subjected to qPCR amplification with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories) and primers (UL54F– 5′ CGCCAAGAAAATTTCATCGAG 3′, and UL54R–5′ ACATCTTGCACCACGCCAG 3′) on the CFX96 thermal cycler. ..

    Article Title: Integrative Bioinformatics, Experimental Validation, and Interpretable Machine Learning Reveal Oxyresveratrol-Mediated Protection Against Cadmium-Induced Lung Adenocarcinoma-Related Transcriptional Dysregulation.
    Article Snippet: .. Quantitative PCR analysis was conducted employing the SYBR Green chemistry, using the SsoAdvanced Universal SYBR Green Supermix (Bio- Rad, Hercules, CA, USA). ..

    Article Title: Generation of spinal cord organoids from human induced pluripotent stem cells caudalised to a lumbar fate.
    Article Snippet: Real-time qPCR for spinal cord region specification Five day 40 organoids were pooled per sample from each differentiation (3 independent differentiations) and RNA was extracted using the RNeasy Mini kit (Qiagen 74104) and RNaseFree DNase set (QIAGEN 79254) as per manufacturer’s protocol. .. For RT-PCR, cDNA was reverse transcribed from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad 1708891). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad 1725271) on a CFX96 machine (Bio-Rad). ..

    Article Title: Characterization of Tiroler Bergkäse PDO cheese: A multimethodological approach
    Article Snippet: The template DNAs of the strains used to create the calibration curves (Supplementary Material, Fig. S2 – S8) were purchased from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) ( ). .. For the primer pairs adopted from , the qPCR assays were performed in a total reaction mix volume of 12 μL, containing 6 μL 2 × SSoAdvanced Universal SYBR® Green Supermix (Bio Rad, Hercules, USA), 500 nM of forward and reverse primers and 2 μL of DNA (c = 1 ng/μL). ..

    Quantitative RT-PCR:

    Article Title: Nickase NmCas9 unsilences paternal Ube3a in a mouse model of Angelman syndrome without causing AAV vector integration.
    Article Snippet: We treated total RNA with ezDNase and reverse transcribed using SuperScript IV VILO (11766050, Invitrogen). .. We performed all RT-qPCR experiments using SsoAdvanced Universal SYBR Green Supermix (1725271, Bio-Rad) or PowerTrack SYBR Green Mastermix (A46109, Applied Biosystems) on a QuantStudio5 (Applied Biosystems). ..

    Article Title: Separating food intake-dependent and -independent effects in cancer cachexia
    Article Snippet: One microgram of purified RNA was converted to cDNA using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, #1708840). .. The diluted cDNA was used for RT-qPCR using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, #1725270) with the CFX384 Real-Time PCR detection System (Bio-Rad). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Separating food intake-dependent and -independent effects in cancer cachexia
    Article Snippet: One microgram of purified RNA was converted to cDNA using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, #1708840). .. The diluted cDNA was used for RT-qPCR using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, #1725270) with the CFX384 Real-Time PCR detection System (Bio-Rad). ..

    Article Title: Extracts from the Edible Mushroom Sparassis crispa : Nematicidal, Antimicrobial, and Antiviral Properties Supporting Its Functional Food Potential.
    Article Snippet: .. The DNA isolates from anti-HSV-1 assays were subjected to qPCR amplification with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories) and primers (UL54F– 5′ CGCCAAGAAAATTTCATCGAG 3′, and UL54R–5′ ACATCTTGCACCACGCCAG 3′) on the CFX96 thermal cycler. ..

    Article Title: Integrative Bioinformatics, Experimental Validation, and Interpretable Machine Learning Reveal Oxyresveratrol-Mediated Protection Against Cadmium-Induced Lung Adenocarcinoma-Related Transcriptional Dysregulation.
    Article Snippet: .. Quantitative PCR analysis was conducted employing the SYBR Green chemistry, using the SsoAdvanced Universal SYBR Green Supermix (Bio- Rad, Hercules, CA, USA). ..

    Article Title: Generation of spinal cord organoids from human induced pluripotent stem cells caudalised to a lumbar fate.
    Article Snippet: Real-time qPCR for spinal cord region specification Five day 40 organoids were pooled per sample from each differentiation (3 independent differentiations) and RNA was extracted using the RNeasy Mini kit (Qiagen 74104) and RNaseFree DNase set (QIAGEN 79254) as per manufacturer’s protocol. .. For RT-PCR, cDNA was reverse transcribed from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad 1708891). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad 1725271) on a CFX96 machine (Bio-Rad). ..

    Article Title: Characterization of Tiroler Bergkäse PDO cheese: A multimethodological approach
    Article Snippet: The template DNAs of the strains used to create the calibration curves (Supplementary Material, Fig. S2 – S8) were purchased from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) ( ). .. For the primer pairs adopted from , the qPCR assays were performed in a total reaction mix volume of 12 μL, containing 6 μL 2 × SSoAdvanced Universal SYBR® Green Supermix (Bio Rad, Hercules, USA), 500 nM of forward and reverse primers and 2 μL of DNA (c = 1 ng/μL). ..

    Amplification:

    Article Title: Extracts from the Edible Mushroom Sparassis crispa : Nematicidal, Antimicrobial, and Antiviral Properties Supporting Its Functional Food Potential.
    Article Snippet: .. The DNA isolates from anti-HSV-1 assays were subjected to qPCR amplification with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories) and primers (UL54F– 5′ CGCCAAGAAAATTTCATCGAG 3′, and UL54R–5′ ACATCTTGCACCACGCCAG 3′) on the CFX96 thermal cycler. ..

    Reverse Transcription:

    Article Title: Generation of spinal cord organoids from human induced pluripotent stem cells caudalised to a lumbar fate.
    Article Snippet: Real-time qPCR for spinal cord region specification Five day 40 organoids were pooled per sample from each differentiation (3 independent differentiations) and RNA was extracted using the RNeasy Mini kit (Qiagen 74104) and RNaseFree DNase set (QIAGEN 79254) as per manufacturer’s protocol. .. For RT-PCR, cDNA was reverse transcribed from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad 1708891). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad 1725271) on a CFX96 machine (Bio-Rad). ..

    cDNA Synthesis:

    Article Title: Generation of spinal cord organoids from human induced pluripotent stem cells caudalised to a lumbar fate.
    Article Snippet: Real-time qPCR for spinal cord region specification Five day 40 organoids were pooled per sample from each differentiation (3 independent differentiations) and RNA was extracted using the RNeasy Mini kit (Qiagen 74104) and RNaseFree DNase set (QIAGEN 79254) as per manufacturer’s protocol. .. For RT-PCR, cDNA was reverse transcribed from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad 1708891). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad 1725271) on a CFX96 machine (Bio-Rad). ..



    Similar Products

    99
    Bio-Rad ssoadvanced sybr green supermix
    Ssoadvanced Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc13116153-279-18-24
    Average 99 stars, based on 1 article reviews
    ssoadvanced sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad ssoadvanced universal sybr green supermix
    Ssoadvanced Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc12807818-110-26-31
    Average 99 stars, based on 1 article reviews
    ssoadvanced universal sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad ssoadvancedtm universal sybr green supermix
    Ssoadvancedtm Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pm42146009-83-5-10
    Average 99 stars, based on 1 article reviews
    ssoadvancedtm universal sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad sso advanced universal sybr green supermix
    Sso Advanced Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc13183384-94-8-14
    Average 99 stars, based on 1 article reviews
    sso advanced universal sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad 2 × ssoadvancedtm universal sybr green supermix

    2 × Ssoadvancedtm Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ssoadvanced+universal+sybr+green+supermix/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc13157175-6-0-7
    Average 99 stars, based on 1 article reviews
    2 × ssoadvancedtm universal sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Integrated multiomics reveals starvation-driven keratin degradation and persistence in Fervidobacterium islandicum AW-1

    doi: 10.1016/j.isci.2026.115755

    Figure Lengend Snippet:

    Article Snippet: 2× SsoAdvancedTM Universal SYBR Green Supermix , Bio-Rad, CA, USA , Cat# 1725271.

    Techniques: Recombinant, cDNA Synthesis, SYBR Green Assay, Sample Prep, Enzyme-linked Immunosorbent Assay, Software, Electron Microscopy, Transmission Assay, Confocal Laser Scanning Microscopy, Mass Spectrometry